[Tritium labeling of RNA and protein of bacteriophage MS2].

Thermal activation of tritium gas is used for labeling of the nucleoprotein, phage MS 2. The obtained preparation of tritiated phage has a specific radioactivity of 20-50 Ci/mmole, is considerably infectious and appears suitable for a wide range of studies. The radioactivity is distributed between intraphage RNA and phage outer protein (approximately 1:3 ratio).

[Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene].

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene.

[General method of isolation and analysis of polynucleotide fragments cross-linked with proteins].

A fragment of 16S RNA, cross-linked to S7 protein by UV irradiation of the 30S subunit of E. coli ribosome, was obtained by the action of T1 ribonuclease on the irradiated nucleoprotein. The digest was treated with polynucleotide kinase in the presence of [gamma-32P]ATP and the S7-cross-linked oligonucleotides were isolated.

[Ribosomal proteins directly interacting with fMet-tRNAfMet in the 30S initiation complex].

By means of ultraviolet-induced (254nm) RNA-protein cross-links it is shown, that tRNAfMet inside the preinitiation complex, formed by binding of fMet-tRNAfMet with 30S subunit of E. coli ribosome and RNA of the phage MS2 in the presence of initiation factors, directly interacts with proteins S4, S5, S9, S11, S14 and S15-S17.

[Principles of selective inactivation of the virus genome. IV. The effect of UV-irradiation of phage MS2 on its binding with anti-MS2-immunoglobulins].

Ultraviolet (254 nm) irradiation of the bacteriophage MS2 results in the decrease of the number of antigenic determinants exposed on the virion surface. The cross-section of the decrease, as measured by the number of anti-MS2 IgG molecules bound per virion, is 10(-16) mm2 per photon. The decrease of the phage-antibody binding proceeds after irradiation with a rate constant of about 5 x 10(-3) min-1.