Publications by authors named "Downes M"

The development of pulmonary oedema following the relief of upper airway obstruction has been reported in a wide range of conditions including post-anaesthetic laryngospasm. Radiologists should be aware of this condition as a complication of general anaesthesia.

View Article and Find Full Text PDF

Retinoids (all trans and 9-cis retinoic acid) are pleiotropic regulators of cell fate, and have been shown to regulate the expression of helix loop helix transcription factors (e.g MyoD, myogenin and Myf-5) that control myogenic differentiation. The effects of retinoids are mediated through the ligand dependent retinoic acid receptors (RARs) and retinoid X receptors (RXRs).

View Article and Find Full Text PDF

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3').

View Article and Find Full Text PDF

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al.

View Article and Find Full Text PDF

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner.

View Article and Find Full Text PDF

The diagnostic and complication rates of 104 percutaneous renal biopsies performed for diffuse renal disease in native kidneys were retrospectively reviewed. Biopsies were performed by one radiologist using continuous ultrasound guidance and a 14-gauge biopsy needle in an automated gun (Biopty TM, Radiplast TM, Uppsala). 103 of 104 (99%) biopsies resulted in adequate tissue for a definitive histological diagnosis which improves on previously published diagnostic rates.

View Article and Find Full Text PDF

Previous studies have failed to fully establish whether ototoxicity is related in any way to the levels of an aminoglycoside antibiotic in the perilymph. To study this we exposed guinea pigs to continuously infused amikacin at four different dosing rates under conditions parallel to those used in our previous study which related ototoxicity to total plasma area under the concentration-time curve regardless of the level in plasma. It was found that at all dosing rates, levels in the perilymph and ratios of levels in perilymph/plasma remained constant as the dosing duration increased from nonototoxic to strongly ototoxic.

View Article and Find Full Text PDF

The use of nucleic acid probes directly labeled with horseradish peroxidase for detection of single copy sequences on Southern blots of human genomic DNA by enhanced chemiluminescence is described. Of the target sequences, 6 x 10(5) molecules (1 amol) have been detected on blue sensitive film using exposures of up to 60 min and probes of 0.3-5.

View Article and Find Full Text PDF

Nitrite and nitrous oxide made up 40% of the hypolimnetic dissolved inorganic nitrogen in mesotrophic Lake Rotoiti, New Zealand, prior to hypolimnetic anoxia. Up to 120 mg of N m-3 as nitrite and 20 mg of N m-3 as nitrous oxide accumulated, whereas dissolved-oxygen concentrations remained between 1.0 and 0.

View Article and Find Full Text PDF

Four monoclonal antibodies were raised against polypeptides present in a high-salt detergent-insoluble fraction from cells of Chlamydomonas reinhardtii. Indirect immunofluorescence microscopy of fibroblasts and epithelial cells grown in culture using these plant antibodies revealed staining arrays identical to those obtained with well characterised antibodies to animal intermediate filaments. Immunofluorescence microscopy of Chlamydomonas with these monoclonal antibodies and a monoclonal antibody that recognises all animal intermediate filaments (anti-IFA) gave a diffuse, patchy cytoplasmic staining pattern.

View Article and Find Full Text PDF

A panel of monoclonal antibodies to neurofilaments have been investigated with regard to the location of their respective epitopes on neurofilament polypeptides and their ability to label the neurofibrillary tangles and paired helical filaments (PHF) which are characteristic of Alzheimer's disease. All of the neurofilament monoclonal antibodies that label tangles and PHF are directed against epitopes in the side arm domains of the two larger neurofilament polypeptides, NF-H and NF-M, and do not recognise the alpha-helical rod domains of these proteins. Immuno-electron microscopy demonstrates that the neurofilament antibodies label the constituent PHF per se and do not simply stain neurofilaments that might be admixed with PHF.

View Article and Find Full Text PDF

To assess the self-concept and psychological profile associated with sexual abuse, 20 young female victims evaluated in a sexual abuse clinic completed the Offer Self-Image Questionnaire (OSIQ). The alleged assault was intrafamilial in 13 cases, lasting from several months to 10 years. Extrafamilial abuses were isolated events.

View Article and Find Full Text PDF

Both nitrate and nitrous oxide accumulate in the hypolimnion of the oligotrophic Lake Taupo, New Zealand, throughout stratification. The two forms of oxidized nitrogen increase in concentration with increasing depth toward the sediments, where the dissolved concentrations of reduced nitrogen are two orders of magnitude higher than concentrations in the overlying water. Nitrification rates were measured by dark [C]CO(2) assays with and without the inhibitor nitrapyrin.

View Article and Find Full Text PDF

A double blind trial is described comparing two methods of bowel preparation prior to barium enema. In 40 randomly selected patients a significant improvement was obtained by the use of an intestinal perfusion method.

View Article and Find Full Text PDF

A method has been devised for the determination of nitrite at low level that is directly applicable to food or other dried matrices without prior extraction. Nitric oxide released from nitrite through the action of acetic acid is determined using a chemiluminescence analyser. The limit of detection is approximately 0.

View Article and Find Full Text PDF