[Analysis of the genetic constructs expressing antiviral siRNAs in the non-viral test system].

The efficiency of RNA interference triggered by the genetic constructs encoding siRNAs and directed against human immunodeficiency virus type 1 (HIV-1) transcripts was investigated in the non-viral test system. The investigation showed 6 biologically active siRNAs attacking 6 conservative targets in the HIV-1 genome. Expression of these genetic constructs failed to induce a nonspecific interferon response.

[RNA interference is developmentally regulated: analysis of expression of suffix, a short Drosophila retroelement].

Sense and antisense transcripts of suffix and F element were detected at different stages of Drosophila development. A short RNA, similar in size to the full-length suffix transcript, was also found. It was suggested that it could originate from the master copy of the element.

[Analysis of the suffix short retroelement copies and the encoded protein domain of Drosophila].

To analyze the copies of the suffix short retro-element, its homologs were sought in nucleic acid sequence databases of the Drosophila melanogaster genome. The search yielded several conserved (near identical in sequence) copies, which are indicative of recent suffix transposition, and numerous divergent copies, which suggest ancient suffix transposition. Analysis of the short suffix ORF revealed a conserved protein domain, which was also found as the eighth C-terminal domain in reverse transcriptases of certain long interspersed elements (LINEs).

[Generation of Kruppel phenocopies by injecting into Drosophila embryos RNA complementary to mRNA in parallel orientation].

RNA preparations synthesized in vitro were used to study the influence of RNA interference on the Kruppel gene activity in Drosophila embryos. RNA complementary in parallel orientation to the mRNA fragment proved to induce the development of Kruppel phenocopies. The data obtained indicate that mechanisms of specific regulation of gene activity exist in Drosophila cells, which are sensitive to the formation of both parallel and antiparallel RNA-RNA duplexes that include mRNA of the corresponding gene.

[RNA interference in Escherichia coli cells: the expression of molecules that are complementary to the lon gene mRNA in parallel orientation].

To study the effect of RNA interference (RNAi) on the activity of gene lon in Escherichia coli, genetic constructs were used that could express RNA molecules complementary to the 5' region of lon mRNA in the same direction. These RNAs were termed parallel RNAs (pRNAs). Two approaches were used to control expression.

[Localization of transcripts corresponding to different regions of the "cut" locus in Drosophila embryos].

Transcripts of the cut locus were localized in Drosophila embryos with use of nonradioactive in situ hybridization. DIG-labeled probes were generated from two locus regions located at position -130. Distal and proximal regions were found to be transcribed in the same tissues throughout embryogenesis.

[Molecular analysis of integration sites of the drosophila retrotransposon burdock].

Data on molecular analysis of the insertion sites of nine random copies of burdock retrotransposon are presented. The 12-bp consensus sequence of the insertion sites, YNNUTUTUYAYA (Y-pyrimidine; U-purine), was determined. Homology between the burdock sequence and ribosomal genes was revealed.

[Molecular analysis of a copy of the novel mobile element Burdock and the region of its insertion into the cut locus of Drosophila melanogaster].

Molecular analysis of a copy of the novel mobile element burdock and its insertion region into the cut locus of Drosophila was performed. The burdock was shown to be a retrotransposon containing a single open reading frame (ORF). It does not contain domens coding for protease, RNAse H, reverse transcriptase, and integrase, which are required for transposition.

[The role of retroelements in evolution: an analysis of the suffix element from the Drosophila genome].

The investigation of sequences homologous to the suffix chains from Drosophila genome revealed the central domain of the element homologous to 16S ribosomal sequence from endosymbiotic organisms. The opposite strand of the element encodes C-domains of reverse transcriptase enzyme in F- and Doc-elements. 19 DNA clones possessing PCR-amplified stretches of genomic DNA were sequenced.

[Analysis of copies of the suffix-retroposon of Drosophila, produced using PCR on genomic DNA].

Nineteen DNA clones, containing copies of the suffix element retroposon of the Drosophila genome and produced by a polymerase chain reaction (PCR), were sequenced. Insertions of the copies in both orientations into microsatellite sequences (CAACA)n/(TGTTG)n and (TTTGT)n/(CACAAA)n were revealed. It was found that, if the microsatellite sequence has both a decanucleotide GCGGCCCGGG (GC-box) and a colinear alternating sequence (A)5(T)4(A)3(T)2(A)1(t)n (AT-box), the insertion of the suffix occurs in only one orientation.

[Conformational transition of parallel DNA in solutions with decreased water activity].

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap.