Publications by authors named "Churikov N"

The efficiency of RNA interference triggered by the genetic constructs encoding siRNAs and directed against human immunodeficiency virus type 1 (HIV-1) transcripts was investigated in the non-viral test system. The investigation showed 6 biologically active siRNAs attacking 6 conservative targets in the HIV-1 genome. Expression of these genetic constructs failed to induce a nonspecific interferon response.

View Article and Find Full Text PDF

Sense and antisense transcripts of suffix and F element were detected at different stages of Drosophila development. A short RNA, similar in size to the full-length suffix transcript, was also found. It was suggested that it could originate from the master copy of the element.

View Article and Find Full Text PDF

To analyze the copies of the suffix short retro-element, its homologs were sought in nucleic acid sequence databases of the Drosophila melanogaster genome. The search yielded several conserved (near identical in sequence) copies, which are indicative of recent suffix transposition, and numerous divergent copies, which suggest ancient suffix transposition. Analysis of the short suffix ORF revealed a conserved protein domain, which was also found as the eighth C-terminal domain in reverse transcriptases of certain long interspersed elements (LINEs).

View Article and Find Full Text PDF

RNA preparations synthesized in vitro were used to study the influence of RNA interference on the Kruppel gene activity in Drosophila embryos. RNA complementary in parallel orientation to the mRNA fragment proved to induce the development of Kruppel phenocopies. The data obtained indicate that mechanisms of specific regulation of gene activity exist in Drosophila cells, which are sensitive to the formation of both parallel and antiparallel RNA-RNA duplexes that include mRNA of the corresponding gene.

View Article and Find Full Text PDF

To study the effect of RNA interference (RNAi) on the activity of gene lon in Escherichia coli, genetic constructs were used that could express RNA molecules complementary to the 5' region of lon mRNA in the same direction. These RNAs were termed parallel RNAs (pRNAs). Two approaches were used to control expression.

View Article and Find Full Text PDF

Transcripts of the cut locus were localized in Drosophila embryos with use of nonradioactive in situ hybridization. DIG-labeled probes were generated from two locus regions located at position -130. Distal and proximal regions were found to be transcribed in the same tissues throughout embryogenesis.

View Article and Find Full Text PDF

Data on molecular analysis of the insertion sites of nine random copies of burdock retrotransposon are presented. The 12-bp consensus sequence of the insertion sites, YNNUTUTUYAYA (Y-pyrimidine; U-purine), was determined. Homology between the burdock sequence and ribosomal genes was revealed.

View Article and Find Full Text PDF

Molecular analysis of a copy of the novel mobile element burdock and its insertion region into the cut locus of Drosophila was performed. The burdock was shown to be a retrotransposon containing a single open reading frame (ORF). It does not contain domens coding for protease, RNAse H, reverse transcriptase, and integrase, which are required for transposition.

View Article and Find Full Text PDF

The investigation of sequences homologous to the suffix chains from Drosophila genome revealed the central domain of the element homologous to 16S ribosomal sequence from endosymbiotic organisms. The opposite strand of the element encodes C-domains of reverse transcriptase enzyme in F- and Doc-elements. 19 DNA clones possessing PCR-amplified stretches of genomic DNA were sequenced.

View Article and Find Full Text PDF

Nineteen DNA clones, containing copies of the suffix element retroposon of the Drosophila genome and produced by a polymerase chain reaction (PCR), were sequenced. Insertions of the copies in both orientations into microsatellite sequences (CAACA)n/(TGTTG)n and (TTTGT)n/(CACAAA)n were revealed. It was found that, if the microsatellite sequence has both a decanucleotide GCGGCCCGGG (GC-box) and a colinear alternating sequence (A)5(T)4(A)3(T)2(A)1(t)n (AT-box), the insertion of the suffix occurs in only one orientation.

View Article and Find Full Text PDF

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap.

View Article and Find Full Text PDF