Objectives: The aim of this study was to describe an alternative landmark for screw insertion into the body of the ilium with bilateral sacroiliac luxation in cats.
Methods: Seven cat cadavers with artificially induced bilateral sacroiliac luxation were used. The screw insertion point was determined using the caudal iliac crest and cranial acetabular rim.
Bioorg Med Chem Lett
June 2012
Chalcones have an affinity for many receptors, enzymes, and transcription factors as flavonoid analogues. Their most studied pharmacological action is that of vasodilatation due to inhibition of phosphodiesterase 5A1 (PDE5A1). To this end, we have established a recursive partitioning model with 3 chemical descriptors for the prediction of compounds that can inhibit PDE5A1.
View Article and Find Full Text PDFHepatitis C virus (HCV) is the major etiological agent of non-A, non-B hepatitis where no effective treatment is available. The HCV NS5B with RNA-dependent RNA polymerase (RdRp) activity is a key target for the treatment of HCV infection. Here we report novel NS5B polymerase inhibitors identified by virtual screening and in vitro evaluation of their inhibitory activities.
View Article and Find Full Text PDFIn an effort to minimize side effects associated with low selectivity against PDE isozymes, we have successfully identified a series of 6,7,8-substituted quinzaolines as potent inhibitors of PDE5 with high level of isozyme selectivity, especially against PDE6 and PDE11. PDE5 potency and isozyme selectivity of quinazolines were greatly improved with substitutions both at 6- and 8-position. The synthesis, structure-activity relationships and in vivo efficacy of this novel series of potent PDE5 inhibitors are described.
View Article and Find Full Text PDFUnlabelled: Pharmaceutical industry has been striving to reduce the costs of drug development and increase productivity. Among the many different attempts, drug repositioning (retargeting existing drugs) comes into the spotlight because of its financial efficiency. We introduce IDMap which predicts novel relationships between targets and chemicals and thus is capable of repositioning the marketed drugs by using text mining and chemical structure information.
View Article and Find Full Text PDFAlthough the structure has been elucidated for the binding of colchicine and podophyllotoxin as potent destabilizer for microtubule formation, very little is known about MDL-27048, a competitive inhibitor for colchicine and podophyllotoxin. The structural basis for the interaction of antimitotic agents with tubulin was investigated by molecular modeling, and we propose binding models for MDL-27048 against tubulin. The proposed model was not only consistent with previous competition experiment data between colchicine and MDL-27048, but further suggested an additional binding cavity on tubulin.
View Article and Find Full Text PDFInhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In our study reported here, the effects of 4 highly potent methionine aminopeptidase 2 (MetAP2) inhibitors, IDR-803, IDR-804, IDR-805 and CKD-732 (designed by structure-based molecular modeling), on angiogenesis and tumor growth were assessed. Concentrations of these inhibitors as low as 2.
View Article and Find Full Text PDFHunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T).
View Article and Find Full Text PDF