G-Quadruplex Recognition by Tetraalkylammonium Ions: A New Paradigm for Discrimination between Parallel and Antiparallel G-Quadruplexes.

G-quadruplexes are an important class of noncanonical secondary structures of DNA that exist in the cell and are involved in the regulation of principal genomic events. Any regulatory role of a G-quadruplex in the genome is coupled with the attendant interconversions between the G-quadruplex and duplex states. Much effort has been invested in the quest for agents that can recognize individual G-quadruplexes and shift the associated duplex-G-quadruplex equilibria toward the G-quadruplex state.

Heat capacity changes associated with G-quadruplex unfolding.

G-quadruplexes are four-stranded DNA structures that have been found in the cell and are thought to act as elements of control in genomic events. The measurements of the thermodynamic stability, ΔG, of G-quadruplexes shed light on the molecular forces involved in the stabilization of these structures. In thermodynamic studies, the differential heat capacity, ΔCP, of the folded and unfolded states of a G-quadruplex is a fundamental property that describes the temperature dependences of the differential enthalpy, ΔH, entropy, ΔS, and free energy, ΔG.

Tribute to Kenneth J. Breslauer.

It is an exciting experience to serve as guest editor for a Special Issue celebrating the 75th birthday of Professor Kenneth J [...

Distribution of Conformational States Adopted by DNA from the Promoter Regions of the VEGF and Bcl-2 Oncogenes.

We employed a previously described procedure, based on circular dichroism (CD) spectroscopy, to quantify the distribution of conformational states adopted by equimolar mixtures of complementary G-rich and C-rich DNA strands from the promoter regions of the VEGF and Bcl-2 oncogenes. Spectra were recorded at different pHs, concentrations of KCl, and temperatures. The temperature dependences of the fractional populations of the duplex, G-quadruplex, -motif, and coiled conformations of each promoter were then analyzed within the framework of a thermodynamic model to obtain the enthalpy and melting temperature of each folded-to-unfolded transition involved in the equilibrium.

Stabilization of G-Quadruplex-Duplex Hybrid Structures Induced by Minor Groove-Binding Drugs.

Once it had been realized that G-quadruplexes exist in the cell and are involved in regulation of genomic processes, the quest for ligands recognizing these noncanonical structures was underway. Many organic compounds that tightly associate with G-quadruplexes have been identified. However, the specificity of G-quadruplex-binding ligands towards individual structures remains problematic, as the common recognition element of these ligands is the G-tetrad.

Volumetric Properties of Four-Stranded DNA Structures.

Four-stranded non-canonical DNA structures including G-quadruplexes and -motifs have been found in the genome and are thought to be involved in regulation of biological function. These structures have been implicated in telomere biology, genomic instability, and regulation of transcription and translation events. To gain an understanding of the molecular determinants underlying the biological role of four-stranded DNA structures, their biophysical properties have been extensively studied.

Volumetric Interplay between the Conformational States Adopted by Guanine-Rich DNA from the c-MYC Promoter.

The kinetic and thermodynamic stabilities of G-quadruplex structures have been extensively studied. In contrast, systematic investigations of the volumetric properties of G-quadruplexes determining their pressure stability are still relatively scarce. The G-rich strand from the promoter region of the c-MYC oncogene (G-strand) is known to adopt a range of conformational states including the duplex, G-quadruplex, and coil states depending on the presence of the complementary C-rich strand (C-strand) and solution conditions.

Duplex-tetraplex equilibria in guanine- and cytosine-rich DNA.

Noncanonical four-stranded DNA structures, including G-quadruplexes and i-motifs, have been discovered in the cell and are implicated in a variety of genomic regulatory functions. The tendency of a specific guanine- and cytosine-rich region of genomic DNA to adopt a four-stranded conformation depends on its ability to overcome the constraints of duplex base-pairing by undergoing consecutive duplex-to-coil and coil-to-tetraplex transitions. The latter ability is determined by the balance between the free energies of participating ordered and disordered structures.

Conformational Preferences of DNA Strands from the Promoter Region of the c-MYC Oncogene.

We characterized the conformational preferences of DNA in an equimolar mixture of complementary G-rich and C-rich strands from the promoter region of the c-MYC oncogene. Our CD-based approach presupposes that the CD spectrum of such a mixture is the spectral sum of the constituent duplex, G-quadruplex, -motif, and coiled conformations. Spectra were acquired over a range of temperatures at different pHs and concentrations of KCl.

On urea and temperature dependences of m-values.

The denaturing or stabilizing influence of a cosolvent on a protein structure is governed by a fine balance of the energetics of the excluded volume effect and the energetics of direct protein-cosolvent interactions. We have previously characterized the energetic contributions of excluded volume and direct interactions with urea for proteins and protein groups. In this work, we examine the molecular origins underlying the relatively weak temperature and urea dependences of the m-values of globular proteins.

On empirical decomposition of volumetric data.

Volumetric characterization of proteins and their recognition events has been instrumental in providing information on the role of intra- and intermolecular interactions, including hydration, in stabilizing biomolecules. The credibility of molecular models and interpretation schemes used to rationalize experimental data are essential for the validity of microscopic insights derived from volumetric results. Current empirical schemes used to interpret volumetric data suffer from a lack of theoretical and computational substantiation.

Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN).

Effect of Urea on G-Quadruplex Stability.

G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids.

Volumetrically Derived Thermodynamic Profile of Interactions of Urea with a Native Protein.

We report the first experimental characterization of the full thermodynamic profile for binding of urea to a native protein. We measured the volumetric parameters of lysozyme at pH 7.0 as a function of urea within a temperature range of 18-45 °C.

Effect of urea on protein-ligand association.

We combine experimental and theoretical approaches to investigate the influence of a cosolvent on a ligand-protein association event. We apply fluorescence measurements to determining the affinity of the inhibitor tri-N-acetylglucosamine [(GlcNAc)] for lysozyme at urea concentrations ranging from 0 to 8M. Notwithstanding that, at room temperature and neutral pH, lysozyme retains its native conformation up to the solubility limit of urea, the affinity of (GlcNAc) for the protein steadily decreases as the concentration of urea increases.

Thermodynamic linkage analysis of pH-induced folding and unfolding transitions of i-motifs.

We describe the pH-induced folding/unfolding transitions of i-motifs by a linkage thermodynamics-based formalism in terms of three pKa's of cytosines, namely, an apparent pKa in the unfolded conformation, pKau, and two apparent pKa's in the folded state, pKaf1 and pKaf2. For the 5'-TTACCCACCCTACCCACCCTCA-3' sequence from the human c-MYC oncogene promoter region, the values of pKau, pKaf1, and pKaf2 are 4.8, 6.

Ionic Effects on VEGF G-Quadruplex Stability.

In a potassium solution, a modified 22-meric DNA sequence Pu22-T12T13 from a region proximal to the transcription initiation site of the human VEGF gene adopts a single parallel-stranded G-quadruplex conformation with a 1:4:1 loop-size arrangement. We measured the thermal stability, TM, of the K(+)-stabilized Pu22-T12T13 G-quadruplex as a function of stabilizing K(+) ions and nonstabilizing Cs(+) and TMA(+) ions. The thermal stability, TM, of the Pu22-T12T13 G-quadruplex increases with the concentration of the stabilizing potassium ions, while it sharply decreases upon the addition of the nonstabilizing cations.

Excluded volume contribution to cosolvent-mediated modulation of macromolecular folding and binding reactions.

Water-miscible cosolvents may stabilize or destabilize proteins, nucleic acids, and their complexes or may exert no influence. The mode of action of a specific cosolvent is determined by the interplay between the excluded volume effect and direct solute-cosolvent interactions. Excluded volume refers to the steric exclusion of water and cosolvent molecules from the space occupied by solute, an event accompanied by a decrease in translational entropy.

Driving Forces in Pressure-Induced Protein Transitions.

The molecular mechanisms underlying pressure-induced protein denaturation can be analyzed based on the pressure-dependent differences in the apparent volume occupied by amino acids inside the protein and when exposed to water in an unfolded conformation. This chapter presents a volumetric analysis of the peptide group and the 20 naturally occurring amino acid side chains in the interior of the native state, the micelle-like interior of the pressure-induced denatured state, and in the unfolded conformation modeled by low-molecular analogs of proteins. The transfer of a peptide group from the protein interior to water becomes increasingly favorable as pressure increases.

Effects of Salt on the Stability of a G-Quadruplex from the Human c-MYC Promoter.

In an atmosphere of potassium ions, a modified c-MYC NHE III1 sequence with two G-to-T mutations (MYC22-G14T/G23T) forms a highly stable parallel-stranded G-quadruplex. The G-quadruplex exhibits a steady increase in its melting temperature, T(M), with an increase in the concentration of the stabilizing cation K(+). On the other hand, an increase in the concentration of nonstabilizing Cs(+) or TMA(+) cations at a constant concentration of K(+) causes a sharp decline in T(M) followed by a leveling off at ∼200 mM Cs(+) or TMA(+).

Effect of cosolvent on protein stability: a theoretical investigation.

We developed a statistical thermodynamic algorithm for analyzing solvent-induced folding/unfolding transitions of proteins. The energetics of protein transitions is governed by the interplay between the cavity formation contribution and the term reflecting direct solute-cosolvent interactions. The latter is viewed as an exchange reaction in which the binding of a cosolvent to a solute is accompanied by release of waters of hydration to the bulk.

Interactions of urea with native and unfolded proteins: a volumetric study.

We describe a statistical thermodynamic approach to analyzing urea-dependent volumetric properties of proteins. We use this approach to analyze our urea-dependent data on the partial molar volume and adiabatic compressibility of lysozyme, apocytochrome c, ribonuclease A, and α-chymotrypsinogen A. The analysis produces the thermodynamic properties of elementary urea-protein association reactions while also yielding estimates of the effective solvent-accessible surface areas of the native and unfolded protein states.

Hydration changes accompanying helix-to-coil DNA transitions.

We applied ultrasonic velocimetric and high-precision densimetric measurements to characterizing the helix-to-coil transition of the GGCATTACGG/CCGTAATGCC decameric DNA duplex. The transition was induced either by temperature or by mixing the two complementary single strands at isothermal conditions. The duplex dissociation causes increases in volume and expansibility while resulting in a decrease in compressibility.

Polyelectrolyte effects in G-quadruplexes.

The role of counterion condensation as a dominant force governing the stability of DNA duplexes and triplexes is well established. In contrast, the effect of counterion condensation on the stability of G-quadrupex conformations is poorly understood. Unlike other ordered nucleic acid structures, G-quadruplexes exhibit a specific binding of counterions (typically, Na(+) or K(+)) which are buried inside the central cavity and coordinated to the O6 carbonyls of the guanines forming the G-quartets.