Carbon Negative Synthesis of Amino Acids Using a Cell-Free-Based Biocatalyst.

Biological systems can directly upgrade carbon dioxide (CO) into chemicals. The CO fixation rate of autotrophic organisms, however, is too slow for industrial utility, and the breadth of engineered metabolic pathways for the synthesis of value-added chemicals is too limited. Biotechnology workhorse organisms with extensively engineered metabolic pathways have recently been engineered for CO fixation.

Systems-Level Modeling for CRISPR-Based Metabolic Engineering.

The CRISPR-Cas system has enabled the development of sophisticated, multigene metabolic engineering programs through the use of guide RNA-directed activation or repression of target genes. To optimize biosynthetic pathways in microbial systems, we need improved models to inform design and implementation of transcriptional programs. Recent progress has resulted in new modeling approaches for identifying gene targets and predicting the efficacy of guide RNA targeting.

Guide RNA structure design enables combinatorial CRISPRa programs for biosynthetic profiling.

Engineering metabolism to efficiently produce chemicals from multi-step pathways requires optimizing multi-gene expression programs to achieve enzyme balance. CRISPR-Cas transcriptional control systems are emerging as important tools for programming multi-gene expression, but poor predictability of guide RNA folding can disrupt expression control. Here, we correlate efficacy of modified guide RNAs (scRNAs) for CRISPR activation (CRISPRa) in E.

CRISPR-Cas tools for simultaneous transcription & translation control in bacteria.

Robust control over gene translation at arbitrary mRNA targets is an outstanding challenge in microbial synthetic biology. The development of tools that can regulate translation will greatly expand our ability to precisely control genes across the genome. In Escherichia coli, most genes are contained in multi-gene operons, which are subject to polar effects where targeting one gene for repression leads to silencing of other genes in the same operon.

CRISPR Tools for Engineering Prokaryotic Systems: Recent Advances and New Applications.

In the past decades, the broad selection of CRISPR-Cas systems has revolutionized biotechnology by enabling multimodal genetic manipulation in diverse organisms. Rooted in a molecular engineering perspective, we recapitulate the different CRISPR components and how they can be designed for specific genetic engineering applications. We first introduce the repertoire of Cas proteins and tethered effectors used to program new biological functions through gene editing and gene regulation.

Engineering activatable promoters for scalable and multi-input CRISPRa/i circuits.

Dynamic, multi-input gene regulatory networks (GRNs) are ubiquitous in nature. Multilayer CRISPR-based genetic circuits hold great promise for building GRNs akin to those found in naturally occurring biological systems. We develop an approach for creating high-performing activatable promoters that can be assembled into deep, wide, and multi-input CRISPR-activation and -interference (CRISPRa/i) GRNs.

Gene expression dynamics in input-responsive engineered living materials programmed for bioproduction.

Engineered living materials (ELMs) fabricated by encapsulating microbes in hydrogels have great potential as bioreactors for sustained bioproduction. While long-term metabolic activity has been demonstrated in these systems, the capacity and dynamics of gene expression over time is not well understood. Thus, we investigate the long-term gene expression dynamics in microbial ELMs constructed using different microbes and hydrogel matrices.

Standards, dissemination, and best practices in systems biology.

The reproducibility of scientific research is crucial to the success of the scientific method. Here, we review the current best practices when publishing mechanistic models in systems biology. We recommend, where possible, to use software engineering strategies such as testing, verification, validation, documentation, versioning, iterative development, and continuous integration.

Perspectives for self-driving labs in synthetic biology.

Self-driving labs (SDLs) combine fully automated experiments with artificial intelligence (AI) that decides the next set of experiments. Taken to their ultimate expression, SDLs could usher a new paradigm of scientific research, where the world is probed, interpreted, and explained by machines for human benefit. While there are functioning SDLs in the fields of chemistry and materials science, we contend that synthetic biology provides a unique opportunity since the genome provides a single target for affecting the incredibly wide repertoire of biological cell behavior.

Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants.

CRISPR-Cas transcriptional tools have been widely applied for programmable regulation of complex biological networks. In comparison to eukaryotic systems, bacterial CRISPR activation (CRISPRa) has stringent target site requirements for effective gene activation. While genes may not always have an NGG protospacer adjacent motif (PAM) at the appropriate position, PAM-flexible dCas9 variants can expand the range of targetable sites.

Multi-layer CRISPRa/i circuits for dynamic genetic programs in cell-free and bacterial systems.

CRISPR-Cas transcriptional circuits hold great promise as platforms for engineering metabolic networks and information processing circuits. Historically, prokaryotic CRISPR control systems have been limited to CRISPRi. Creating approaches to integrate CRISPRa for transcriptional activation with existing CRISPRi-based systems would greatly expand CRISPR circuit design space.

A Smartwatch Paired With A Mobile Application Provides Postoperative Self-Directed Rehabilitation Without Compromising Total Knee Arthroplasty Outcomes: A Randomized Controlled Trial.

Background: Self-directed rehabilitation (SDR) after total knee arthroplasty (TKA) has not been traditionally recommended. The purpose of this study was to determine if there was an impact on postoperative outcomes with the use of an SDR program after primary TKA.

Methods: In this prospective, randomized, multicenter, controlled trial, we paired a smartwatch with a mobile application, providing an SDR program after TKA.

Complex dependence of CRISPR-Cas9 binding strength on guide RNA spacer lengths.

It is established that for CRISPR-Cas9 applications guide RNAs with 17-20 bp long spacer sequences are optimal for accurate target binding and cleavage. In this work we perform cell-free CRISPRa (CRISPR activation) and CRISPRi (CRISPR inhibition) experiments to demonstrate the existence of a complex dependence of CRISPR-Cas9 binding as a function of the spacer length and complementarity. Our results show that significantly truncated or mismatched spacer sequences can form stronger guide-target bonds than the conventional 17-20 bp long spacers.

Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida.

CRISPR-Cas transcriptional programming in bacteria is an emerging tool to regulate gene expression for metabolic pathway engineering. Here we implement CRISPR-Cas transcriptional activation (CRISPRa) in P. putida using a system previously developed in E.

Membrane Augmented Cell-Free Systems: A New Frontier in Biotechnology.

Membrane proteins are present in a wide array of cellular processes from primary and secondary metabolite synthesis to electron transport and single carbon metabolism. A key barrier to applying membrane proteins industrially is their difficult functional production. Beyond expression, folding, and membrane insertion, membrane protein activity is influenced by the physicochemical properties of the associated membrane, making it difficult to achieve optimal membrane protein performance outside the endogenous host.

Challenges and opportunities with CRISPR activation in bacteria for data-driven metabolic engineering.

Creating CRISPR gene activation (CRISPRa) technologies in industrially promising bacteria could be transformative for accelerating data-driven metabolic engineering and strain design. CRISPRa has been widely used in eukaryotes, but applications in bacterial systems have remained limited. Recent work shows that multiple features of bacterial promoters impose stringent requirements on CRISPRa-mediated gene activation.

Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements.

In bacterial systems, CRISPR-Cas transcriptional activation (CRISPRa) has the potential to dramatically expand our ability to regulate gene expression, but we lack predictive rules for designing effective gRNA target sites. Here, we identify multiple features of bacterial promoters that impose stringent requirements on CRISPRa target sites. Notably, we observe narrow, 2-4 base windows of effective sites with a periodicity corresponding to one helical turn of DNA, spanning ~40 bases and centered ~80 bases upstream of the TSS.

EXHANCE-3: a cohort study of the exhalation delivery system with fluticasone for chronic sinusitis with or without nasal polyps.

Background: Inhaled nasal corticosteroid sprays (INS) are often inadequate to treat chronic rhinosinusitis (CRS). The exhalation delivery system with fluticasone (EDS-FLU; XHANCE®) may improve outcomes in CRS by increasing medication delivery to target superior/posterior anatomic sites. This study assessed safety and efficacy of EDS-FLU in a large population with moderate-to-severe CRS with or without nasal polyps (CRSwNP, CRSsNP).

A Randomized Comparison of the Pharmacokinetics and Bioavailability of Fluticasone Propionate Delivered via Xhance Exhalation Delivery System Versus Flonase Nasal Spray and Flovent HFA Inhalational Aerosol.

Purpose: The exhalation delivery system with fluticasone propionate (Xhance®) has been shown to deliver drug substantially more broadly in the nasal cavity (particularly into superior/posterior regions), with less off-target loss of drug to drip-out and swallowing, than conventional nasal sprays. This open-label study evaluated the systemic bioavailability of Xhance® by comparing the pharmacokinetic (PK) properties of a single dose of fluticasone from 3 products administering the drug using 3 different devices: Xhance®, Flonase® (fluticasone propionate inhalational nasal spray), and Flovent® HFA (fluticasone propionate inhalational aerosol).

Methods: This open-label study was conducted in 2 parts.

Isolation and Characterization of Bacterial Cellulase Producers for Biomass Deconstruction: A Microbiology Laboratory Course.

The conversion of biomass to biofuels presents a solution to one of the largest global challenges of our era, climate change. A critical part of this pipeline is the process of breaking down cellulosic sugars from plant matter to be used by microbes containing biosynthetic pathways that produce biofuels or bioproducts. In this inquiry-based course, students complete a research project that isolates cellulase-producing bacteria from samples collected from the environment.

NAVIGATE I: Randomized, Placebo-Controlled, Double-Blind Trial of the Exhalation Delivery System With Fluticasone for Chronic Rhinosinusitis With Nasal Polyps.

Background: Chronic rhinosinusitis is a common, high-morbidity chronic inflammatory disease, and patients often experience suboptimal outcomes with current medical treatment. The exhalation delivery system with fluticasone (EDS-FLU) may improve care by increasing superior/posterior intranasal corticosteroid deposition.

Objective: To evaluate the efficacy and safety of EDS-FLU versus EDS-placebo in patients with nasal polyps (NP).

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.