Complexation of the nickel and cobalt transcriptional regulator RcnR with DNA.

RcnR is a transcription factor that regulates the homeostasis of cobalt and nickel in bacterial cells. Escherichia coli RcnR was crystallized with DNA that encompasses the DNA-binding site. X-ray diffraction data were collected to 2.

Thermodynamic investigation of kissing-loop interactions.

Kissing loop interactions (KLIs) are a common motif that is critical in retroviral dimerization, viroid replication, mRNA, and riboswitches. In addition, KLIs are currently used in a variety of biotechnology applications, such as in aptamer sensors, RNA scaffolds and to stabilize vaccines for therapeutics. Here we describe the thermodynamics of a basic intramolecular DNA capable of engaging in a KLI, consisting of two hairpins connected by a flexible linker.

Thermodynamic Stability of DNA Duplexes Comprising the Simplest T → dU Substitutions.

Members of the uracil-DNA glycosylase (UDG) enzyme family recognize and bind uracil, sequestering it within the binding site pocket and catalyzing the cleavage of the base from the deoxyribose, leaving an abasic site. The recognition and binding are passive and rely on innate dynamic motions of DNA wherein base pairs undergo thermally induced breakage and conformational fluctuations. Once the uracil breaks from its base pair, it can be recognized and bound by the enzyme, which then alters its conformation for sequestration and catalysis.

Energetics, Ion, and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

Triplex formation occurs via interaction of a third strand with the major groove of double-stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of polyadenylic acid (poly(rA))·polyuridylic acid (poly(rU)) (duplex) and poly(rA)·2poly(rU) (triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques.

Increased Flexibility between Stems of Intramolecular Three-Way Junctions by the Insertion of Bulges.

Intramolecular junctions are a ubiquitous structure within DNA and RNA; three-way junctions in particular have high strain around the junction because of the lack of flexibility, preventing the junctions from adopting conformations that would allow for optimal folding. In this work, we used a combination of calorimetric and spectroscopic techniques to study the unfolding of four intramolecular three-way junctions. The control three-way junction, 3H, has the sequence d(GAAATTGCGCTGCGCGTGCTGCACAATTTC), which has three arms of different sequences.

Effect of GCAA stabilizing loops on three- and four-way intramolecular junctions.

Tetraloops are a common way of changing the melting behavior of a DNA or RNA structure without changing the sequence of the stem. Because of the ubiquitous nature of tetraloops, our goal is to understand the effect a GCAA tetraloop, which belongs to the GNRA family of tetraloops, has on the unfolding thermodynamics of intramolecular junctions. Specifically, we have described the melting behavior of intramolecular three-way and four-way junctions where a T loop has been replaced with a GCAA tetraloops in different positions.

Effect of dC → d(mC) substitutions on the folding of intramolecular triplexes with mixed TAT and CGC base triplets.

Oligonucleotide-directed triple helix formation has been recognized as a potential tool for targeting genes with high specificity. Cystosine methylation in the 5' position is both ubiquitous and a stable regulatory modification, which could potentially stabilize triple helix formation. In this work, we have used a combination of calorimetric and spectroscopic techniques to study the intramolecular unfolding of four triplexes and two duplexes.

Melting Behavior of a DNA Four-Way Junction Using Spectroscopic and Calorimetric Techniques.

Intramolecular four-way junctions are structures present during homologous recombination, repair of double stranded DNA breaks, and integron recombination. Because of the wide range of biological processes four-way junctions are involved in, understanding how and under what conditions these structures form is critical. In this work, we used a combination of spectroscopic and calorimetric techniques to present a complete thermodynamic description of the unfolding of a DNA four-way junction (FWJ) and its appropriate control stem-loop motifs (Dumbbell, GAAATT-Hp, CTATC-Hp, GTGC-Hp, and GCGC-Hp).

Effect of Loop Length and Sequence on the Stability of DNA Pyrimidine Triplexes with TAT Base Triplets.

We report the thermodynamic contributions of loop length and loop sequence to the overall stability of DNA intramolecular pyrimidine triplexes. Two sets of triplexes were designed: in the first set, the C loop closing the triplex stem was replaced with CTC loops (n = 1-5), whereas in the second set, both the duplex and triplex loops were replaced with a GCAA or AACG tetraloop. For the triplexes with a CTC loop, the triplex with five bases in the loop has the highest stability relative to the control.

An XAS investigation of the nickel site structure in the transcriptional regulator InrS.

InrS (Internal nickel-responsive Sensor) is a transcriptional repressor of the nickel exporter NrsD and de-represses expression of the exporter upon binding Ni(II) ions. Although a crystal structure of apo-InrS has been reported, no structure of the protein with metal ions bound is available. Herein we report the results of metal site structural investigations of Ni(II) and Cu(II) complexes of InrS using X-ray absorption spectroscopy (XAS) that are complementary to data available from the apo-InrS crystal structure, and are consistent with a planar four-coordinate [Ni(His)(Cys)] structure, where the ligands are derived from the side chains of His21, Cys53, His78, and Cys82.

Investigation of the Melting Behavior of DNA Three-Way Junctions in the Closed and Open States.

Intramolecular three-way junctions are commonly found in both DNA and RNA. These structures are functionally relevant in ribozymes, riboswitches, rRNA, and during replication. In this work, we present a thermodynamic description of the unfolding of DNA intramolecular three-way junctions.

Glutamate Ligation in the Ni(II)- and Co(II)-Responsive Escherichia coli Transcriptional Regulator, RcnR.

Escherichia coli RcnR (resistance to cobalt and nickel regulator, EcRcnR) is a metal-responsive repressor of the genes encoding the Ni(II) and Co(II) exporter proteins RcnAB by binding to P. The DNA binding affinity is weakened when the cognate ions Ni(II) and Co(II) bind to EcRcnR in a six-coordinate site that features a (N/O)S ligand donor-atom set in distinct sites: while both metal ions are bound by the N terminus, Cys35, and His64, Co(II) is additionally bound by His3. On the other hand, the noncognate Zn(II) and Cu(I) ions feature a lower coordination number, have a solvent-accessible binding site, and coordinate protein ligands that do not include the N-terminal amine.

Specific metal recognition in nickel trafficking.

Nickel is an essential metal for a number of bacterial species that have developed systems for acquiring, delivering, and incorporating the metal into target enzymes and controlling the levels of nickel in cells to prevent toxic effects. As with other transition metals, these trafficking systems must be able to distinguish between the desired metal and other transition metal ions with similar physical and chemical properties. Because there are few enzymes (targets) that require nickel for activity (e.