S309-CAR-NK cells bind the Omicron variants and reduce SARS-CoV-2 viral loads in humanized ACE2-NSG mice.

Unlabelled: Recent progress on chimeric antigen receptor (CAR)-NK cells has shown promising results in treating CD19-positive lymphoid tumors with minimal toxicities [including graft versus host disease (GvHD) and cytokine release syndrome (CRS) in clinical trials. Nevertheless, the use of CAR-NK cells in combating viral infections has not yet been fully explored. Previous studies have shown that CAR-NK cells expressing S309 single-chain fragment variable (scFv), hereinafter S309-CAR-NK cells, can bind to SARS-CoV-2 wildtype pseudotyped virus (PV) and effectively kill cells expressing wild-type spike protein .

Reproductive Profile of Neuronal Androgen Receptor Knockout Female Mice With a Low Dose of DHT.

Hyperandrogenism and polycystic ovarian syndrome result from the imbalance or increase of androgen levels in females. Androgen receptor (AR) mediates the effects of androgens, and this study examines whether neuronal AR plays a role in reproduction under normal and increased androgen conditions in female mice. The neuron-specific AR knockout (KO) mouse (SynARKO) was generated from a female mouse (synapsin promoter driven Cre) and a male mouse (Ar fl/y).

Neuronal AR Regulates Glucose Homeostasis and Energy Expenditure in Lean Female Mice With Androgen Excess.

Hyperandrogenemia and polycystic ovary syndrome are a result of the imbalance of androgen levels in females. Androgen receptor (Ar) mediates the effect of androgen, and this study examines how neuronal Ar in the central nervous system mediates metabolism under normal and increased androgen conditions in female mice. The neuron-specific ARKO mouse (SynARKO) was created from female (Ar fl/wt; synapsin promoter driven Cre) and male (Ar fl/y) mice.

Defective neurite elongation and branching in Nibp/Trappc9 deficient zebrafish and mice.

Loss of function in transport protein particles (TRAPP) links a new set of emerging genetic disorders called "TRAPPopathies". One such disorder is NIBP syndrome, characterized by microcephaly and intellectual disability, and caused by mutations of , a crucial and unique member of TRAPPII. To investigate the neural cellular/molecular mechanisms underlying microcephaly, we developed Nibp/Trappc9-deficient animal models using different techniques, including morpholino knockdown and CRISPR/Cas mutation in zebrafish and Cre/LoxP-mediated gene targeting in mice.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production.

Comparison of BNT162b2-, mRNA-1273- and Ad26.COV2.S-Elicited IgG and Neutralizing Titers against SARS-CoV-2 and Its Variants.

Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.

Microglia-Specific Promoter Activities of Gene.

Adeno-associated virus (AAV)-mediated genetic targeting of microglia remains a challenge. Overcoming this hurdle is essential for gene editing in the central nervous system (CNS). Here, we characterized the minimal/native promoter of the gene, which is known to be specifically and stably expressed in the microglia during homeostatic and pathological conditions.

Epigallocatechin gallate from green tea effectively blocks infection of SARS-CoV-2 and new variants by inhibiting spike binding to ACE2 receptor.

Background: As the COVID-19 pandemic rages on, the new SARS-CoV-2 variants have emerged in the different regions of the world. These newly emerged variants have mutations in their spike (S) protein that may confer resistance to vaccine-elicited immunity and existing neutralizing antibody therapeutics. Therefore, there is still an urgent need of safe, effective, and affordable agents for prevention/treatment of SARS-CoV-2 and its variant infection.

Novel Scalable and Simplified System to Generate Microglia-Containing Cerebral Organoids From Human Induced Pluripotent Stem Cells.

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues.

Cellular mechanisms underlying neurological/neuropsychiatric manifestations of COVID-19.

Patients with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection manifest mainly respiratory symptoms. However, clinical observations frequently identified neurological symptoms and neuropsychiatric disorders related to COVID-19 (Neuro-SARS2). Accumulated robust evidence indicates that Neuro-SARS2 may play an important role in aggravating the disease severity and mortality.

Emerging role of NIK/IKK2-binding protein (NIBP)/trafficking protein particle complex 9 (TRAPPC9) in nervous system diseases.

NFκB signaling and protein trafficking network play important roles in various biological and pathological processes. NIK-and-IKK2-binding protein (NIBP), also known as trafficking protein particle complex 9 (TRAPPC9), is a prototype member of a novel protein family, and has been shown to regulate both NFκB signaling pathway and protein transport/trafficking. NIBP is extensively expressed in the nervous system and plays an important role in regulating neurogenesis and neuronal differentiation.