Regulation of airway epithelial cell NF-kappa B-dependent gene expression by protein kinase C delta.

Airway epithelial cells synthesize proinflammatory molecules such as IL-8, GM-CSF, RANTES, and ICAM-1, the expression of which is increased in the airways of patients with asthma. We investigated the regulation of these NF-kappa B-dependent genes by the novel protein kinase C (PKC) isoform PKC delta in 16HBE14o- human airway epithelial cells, focusing on IL-8 expression. Transient transfection with the constitutively active catalytic subunit of PKC delta (PKC delta-CAT), and treatment with bryostatin 1, an activator of PKC delta, each increased transcription from the IL-8 promoter, whereas overexpression of PKC epsilon had minor effects.

Ribavirin treatment up-regulates antiviral gene expression via the interferon-stimulated response element in respiratory syncytial virus-infected epithelial cells.

Respiratory syncytial virus (RSV) is a mucosa-restricted virus that is a leading cause of epidemic respiratory tract infections in children. RSV replication is a potent activator of the epithelial-cell genomic response, influencing the expression of a spectrum of cellular pathways, including proinflammatory chemokines of the CC, CXC, and CX(3)C subclasses. Ribavirin (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide) is a nontoxic antiviral agent currently licensed for the treatment of severe RSV lower respiratory tract infections.

Respiratory syncytial virus-induced activation of nuclear factor-kappaB in the lung involves alveolar macrophages and toll-like receptor 4-dependent pathways.

The transcription factor nuclear factor (NF)-kappaB controls the expression of numerous respiratory syncytial virus (RSV)-inducible inflammatory and immunomodulatory genes. Using a BALB/c mouse model, the present article shows that RSV potently and specifically activates NF-kappaB in vivo, a process that involves nuclear translocation of the subunits RelA, p50, and c-Rel in the lung. By depletion of alveolar macrophages (AMs) in BALB/c mice and use of C3H/HeJ mice lacking a functional Toll-like receptor (TLR)-4 signaling pathway, we demonstrate the existence of distinct but sequentially integrated RSV-inducible early NF-kappaB responses in the lung.

Regulation of RANTES promoter activation in alveolar epithelial cells after cytokine stimulation.

Regulated on activation, normal T cell expressed, and presumably secreted (RANTES) is a member of the CC chemokine family of proteins implicated in a variety of diseases characterized by lung eosinophilia and inflammation, strongly produced by stimulated airway epithelial cells. Because such cytokines as tumor necrosis factor (TNF)-alpha and interferon-gamma (IFN-gamma) have been shown to enhance RANTES induction in airway epithelial cells and RANTES gene expression appears to be differentially regulated depending on the cell type and the stimulus applied, in this study we have elucidated mechanisms that operate to control RANTES induction on exposure to TNF-alpha and/or IFN-gamma. Our results indicate that TNF-alpha and IFN-gamma synergistically induce RANTES protein secretion and mRNA expression.

Regulation of human airway epithelial cell IL-8 expression by MAP kinases.

Recent studies indicate that maximal IL-8 protein expression requires activation of NF-kappaB as well as activation of the MAP kinases ERK, JNK, and p38. However, the precise relationship between NF-kappaB transactivation and MAP kinase activation remains unclear. We examined the requirements of NF-kappaB, ERK, JNK, and p38 for TNF-alpha-induced transcription from the IL-8 promoter in a human bronchial epithelial cell line.

Vascular inflammation and the renin-angiotensin system.

It is now well established that vascular inflammation is an independent risk factor for the development of atherosclerosis. In otherwise healthy patients, chronic elevations of circulating interleukin-6 or its biomarkers are predictors for increased risk in the development and progression of ischemic heart disease. Although multifactorial in etiology, vascular inflammation produces atherosclerosis by the continuous recruitment of circulating monocytes into the vessel wall and by contributing to an oxidant-rich inflammatory milieu that induces phenotypic changes in resident (noninflammatory) cells.

MAPK activation is involved in posttranscriptional regulation of RSV-induced RANTES gene expression.

Airway epithelial cells represent the primary cell target of respiratory syncytial virus (RSV) infection. They actively participate in the lung immune/inflammatory response that follows RSV infection by expressing chemokines, small chemotactic cytokines that recruit and activate leukocytes. Regulated on activation, normal T cell expressed, and presumably secreted (RANTES) is a member of the CC chemokine subfamily and is strongly chemotactic for T lymphocytes, monocytes, basophils, and eosinophils, cell types that are present or activated in the inflammatory infiltrate that follows RSV infection of the lung.

Interleukin-8 gene regulation in intestinal epithelial cells infected with rotavirus: role of viral-induced IkappaB kinase activation.

Rotavirus is the major etiologic agent of diarrhea in children and the most common cause of severe pediatric gastroenteritis. Rotavirus infection is limited to mature enterocytes that line the villi of the small intestine. Gut epithelial cells, upon infection and cytokine stimulation, are able to produce chemokines, a family of small chemotactic cytokines that regulate the migration and activation of leukocytes.

Identification of NF-kappaB-dependent gene networks in respiratory syncytial virus-infected cells.

Respiratory syncytial virus (RSV) is a mucosa-restricted virus that is a leading cause of epidemic respiratory tract infections in children. In epithelial cells, RSV replication activates nuclear translocation of the inducible transcription factor nuclear factor kappaB (NF-kappaB) through proteolysis of its cytoplasmic inhibitor, IkappaB. In spite of a putative role in mediating virus-inducible gene expression, the spectrum of NF-kappaB-dependent genes induced by RSV infection has not yet been determined.

Angiotensinogen gene expression is dependent on signal transducer and activator of transcription 3-mediated p300/cAMP response element binding protein-binding protein coactivator recruitment and histone acetyltransferase activity.

Angiotensin II, a potent vasoactive peptide produced by proteolysis of the angiotensinogen (AGT) prohormone, plays a critical role in cardiovascular homeostasis. Recently we showed that IL-6 induces human (h)AGT transcription by activating the signal transducers and activators of transcription (STATs). Here we investigated the role of the coactivator p300/cAMP response element binding protein-binding protein (CBP) in STAT3-mediated hAGT gene expression.

Retriever and CompareTable, two informatics tools for data analysis of high-density oligonucleotide arrays.

High-density oligonucleotide arrays are widely employed for detecting global changes in gene expression profiles of cells or tissues exposed to specific stimuli. Presented with large amounts of data, investigators can spend significant amounts of time analyzing and interpreting this array data. In our application of GeneChip arrays to analyze changes in gene expression in viral-infected epithelium, we have needed to develop additional computational tools that may be of utility to other investigators using this methodology.

Inhibition of proteasome activity blocks the ability of TNF alpha to down-regulate G(i) proteins and stimulate lipolysis.

Prolonged treatment of rat adipocytes with TNF alpha increases lipolysis through a mechanism mediated, in part, by down-regulation of inhibitory G proteins (G(i)). Separately, down-regulation of G(i) by prolonged treatment with an A(1)-adenosine receptor agonist, N(6)-phenylisopropyl adenosine (PIA) increases lipolysis. To investigate the role of proteolysis in TNF alpha and PIA-mediated G(i) down-regulation and stimulation of lipolysis, we used the protease inhibitors lactacystin (proteasome inhibitor) and calpeptin (calpain inhibitor).

Expression of respiratory syncytial virus-induced chemokine gene networks in lower airway epithelial cells revealed by cDNA microarrays.

The Paramyxovirus respiratory syncytial virus (RSV) is the primary etiologic agent of serious epidemic lower respiratory tract disease in infants, immunosuppressed patients, and the elderly. Lower tract infection with RSV is characterized by a pronounced peribronchial mononuclear infiltrate, with eosinophilic and basophilic degranulation. Because RSV replication is restricted to airway epithelial cells, where RSV replication induces potent expression of chemokines, the epithelium is postulated to be a primary initiator of pulmonary inflammation in RSV infection.

NF-kappaB/RelA transactivation is required for atypical protein kinase C iota-mediated cell survival.

In chronic myelogenous leukemia (CML), the oncogene bcr-abl encodes a dysregulated tyrosine kinase that inhibits apoptosis. We showed previously that human erythroleukemia K562 cells are resistant to antineoplastic drug (taxol)-induced apoptosis through the atypical protein kinase C iota isozyme (PKC iota), a kinase downstream of Bcr-Abl. The mechanism(s) by which PKC iota mediates cell survival to taxol is unknown.

Multiple cis regulatory elements control RANTES promoter activity in alveolar epithelial cells infected with respiratory syncytial virus.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normally T-cell expressed and presumably secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study, we analyzed the mechanism of RSV-induced RANTES promoter activation in human type II alveolar epithelial cells (A549 cells).

NF-kappa B-inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-kappa B1 residence.

NF-kappa B is a transcription factor whose nuclear residence is controlled by I kappa B family members. In the NF-kappa B-I kappa B autoregulatory loop, activated (nuclear) Rel A.NF-kappa B1 induces the resynthesis of I kappa B alpha recapturing nuclear Rel A back into the cytoplasm within 1 h of stimulation.

Nonisotopic assays for reporter gene activity.

This unit describes two nonisotopic systems for reporter gene activity in cells transfected with the firefly luciferase.

Oxidant tone regulates RANTES gene expression in airway epithelial cells infected with respiratory syncytial virus. Role in viral-induced interferon regulatory factor activation.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part, through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normal T-cells expressed and secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study we investigated the role of reactive oxygen species in the induction of RANTES gene expression in human type II alveolar epithelial cells (A549), following RSV infection.

Role of signal transducers and activators of transcription 1 and -3 in inducible regulation of the human angiotensinogen gene by interleukin-6.

The circulating level of angiotensinogen (AGT) is dynamically regulated as an important determinant of blood pressure and electrolyte homeostasis. Because the mechanisms controlling the regulated expression of human angiotensinogen (hAGT) are unknown, we investigated the inducible regulation of the hAGT gene in well differentiated HepG2 cells. Interleukin-6 (IL-6) stimulation produced a 3.

IFN-beta mediates coordinate expression of antigen-processing genes in RSV-infected pulmonary epithelial cells.

Major histocompatibility complex (MHC) class I-restricted cytotoxic T lymphocytes (CTLs) clear respiratory tract infections caused by the pneumovirus respiratory syncytial virus (RSV) and also mediate vaccine-induced pulmonary injury. Herein we examined the mechanism for RSV-induced MHC class I presentation. Like infectious viruses, conditioned medium from RSV-infected cells (RSV-CM) induces naive cells to coordinately express a gene cluster encoding the transporter associated with antigen presentation 1 (TAP1) and low molecular mass protein (LMP) 2 and LMP7.

Analysis of Transcriptional Control Mechanisms II Techniques for Characterization of trans-Acting Factors.

cis-Acting DNA control elements, enhancers and promoters, function to control gene expression by acting as targets for specific DNA-binding proteins (trans-acting factors). trans-acting factors are sequence-specific DNA-binding proteins that recognize specific signatures in base composition of the DNA, and upon binding, are able to influence transcriptional activity of the core promoter by multiple diverse mechanisms. These mechanisms include direct interaction with the preinitiation complex, recruitment of additional bridging proteins (coactivators), or induction of chromatin remodeling (such as altering nucleosomal phasing).

A nalysis of Transcriptional Control Mechanisms I : Techniques for Characterization ofcis-Regulatory Elements.

Transcriptional control, the process controlling when and how much RNA is produced from a DNA template, is a major determinant of gene expression in eukaryotic cells. This process, intensely studied over the last few decades, is under control of specific DNA sequences (cis elements) that function by virtue of their ability to be recognized by sequence-specific DNA-binding proteins (trans-acting elements). Both of these elements function in concert to control the rate and location of RNA transcript formation.

Angiotensin II induces gene transcription through cell-type-dependent effects on the nuclear factor-kappaB (NF-kappaB) transcription factor.

The vasopressor octapeptide, angiotensin II (Ang II), exerts homeostatic responses in cardiovascular tissues, including the heart, blood vessel wall, adrenal cortex and liver (a major source of circulating plasma proteins). One of the effects of Ang II is to induce expression of regulatory, structural and cytokine genes that play important roles in long-term control of blood pressure, vascular remodeling, cardiac hypertrophy and inflammation. The identification of nuclear signaling pathways and target transcription factors has provide important insight into cellular responses and the spectrum of genes controlled by Ang II.

A novel glucocorticoid receptor binding element within the murine c-myc promoter.

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element.

Requirement of a novel upstream response element in respiratory syncytial virus-induced IL-8 gene expression.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part, through its ability to induce chemokine synthesis in infected airway epithelial cells. In this study, we compare mechanisms for induction of the CXC chemokine IL-8, in human type II alveolar (A549) cells by RSV infection and by stimulation with the cytokine TNF. Promoter deletion and mutagenesis experiments indicate that although the region from -99 to -54 nt is sufficient for TNF-induced IL-8 transcription, this region alone is not sufficient for RSV-induced IL-8 transcription.