Inhibition of alfalfa mosaic virus RNA and protein synthesis by actinomycin D and cycloheximide.

Actinomycin D, added early after inoculation, reduces the production of infectious alfalfa mosaic virus in cowpea protoplasts by 90%. This reduction was associated with an inhibition of viral minus-strand and plus-strand RNA synthesis, suggesting the involvement of host factors in these processes. Coat protein production was less affected by the drug.

Complete nucleotide sequence of alfalfa mosaic virus RNA 1.

Double-stranded cDNA of alfalfa mosaic virus (AlMV) RNA 1 has been cloned and sequenced. From clones with overlapping inserts, and other sequence data, the complete primary sequence of the 3644 nucleotides of RNA 1 was deduced: a long open reading frame for a protein of Mr 125,685 is flanked by a 5'-terminal sequence of 100 nucleotides and a 3' noncoding region of 163 nucleotides, including the sequence of 145 nucleotides the three genomic RNAs of AlMV have in common. The two UGA-termination codons halfway RNA 1, that were postulated by Van Tol et al.

Coat protein binding sites on RNA 1 of alfalfa mosaic virus.

The largest genome segment, RNA 1, of alfalfa mosaic virus forms complexes with viral coat protein. These complexes were subjected to digestion with ribonucleases T1 or A and filtered onto Millipore filters. Specific fragments were collected from the filters by phenol extraction.

Time course of alfalfa mosaic virus RNA and coat protein synthesis in cowpea protoplasts.

A study was made of the time course of the synthesis of viral plus-strand RNA, minus-strand RNA, and coat protein in alfalfa mosaic virus-infected Cowpea protoplasts. The three genomic RNAs were synthesized at different rates, as were their corresponding minus-strands. We conclude that viral RNA synthesis is regulated both at the level of minus-strand production and the level of plus-strand production.

Replication of temperature-sensitive mutants of alfalfa mosaic virus in protoplasts.

Six mutants of alfalfa mosaic virus (AIMV), previously found to have conditionally lethal defects when inoculated to tobacco leaf discs, were assayed for a temperature-sensitive (ts) phenotype in cowpea protoplasts. At 30 degrees the virus production of four mutants was less than 10% of that obtained at 25 degrees , whereas wild-type AIMV multiplied with similar efficiencies at both temperatures. Supplementation experiments performed in protoplasts with two mutants indicated the presence of mutations on both RNA 1 and RNA 2.

Altered balance of the synthesis of plus- and minus-strand RNAs induced by RNAs 1 and 2 of alfalfa mosaic virus in the absence of RNA 3.

The synthesis of viral plus-strand and minus-strand RNAs in cowpea protoplasts inoculated with mixtures of alfalfa mosaic virus nucleoproteins (B, M, Tb, and Ta) was analyzed by the Northern blotting technique. A mixture of B, M, and Tb induced the synthesis of plus-strand RNAs 1, 2, 3, and 4 and three minus-strand RNAs corresponding to RNAs 1, 2, and 3, respectively. Compared to this complete infection, a mixture of B and M induced the synthesis of a reduced amount of plus-strand RNAs 1 and 2 and a greatly enhanced amount of minus-strand RNAs 1 and 2.

Open reading frame in the minus strand of two plus type RNA viruses.

: Inspection of the nucleotide sequences of the RNAs complementary to the coat protein mRNAs from two plant viruses with a tripartite genome: alfalfa mosaic virus and brome mosaic virus, showed the presence of open reading frames for 138 and 118 amino acids, respectively. A third virus (cowpea chlorotic mottle virus) from the same family (1) does not show this phenomenon. This suggests that if a protein is coded for by the open reading frames it may be not essential for virus multiplication.

Nucleotide sequences at the 5'-termini of the alfalfa mosaic virus RNAs and the intercistronic junction in RNA 3.

Nucleotide sequences at the 5'-termini of the alfalfa mosaic virus genomic RNAs and the intercistronic junction in RNA 3 were deduced and compared to identify possible common recognition signals for replicating enzymes in the corresponding minus-stranded viral RNAs. Homology between the 5'-terminal sequences is less than 11 nucleotides and no complementarity with the homologous sequence occurring at the 3'-end of the viral RNAs was observed. Homology between the 5'-terminus and intercistronic region in RNA 3 is compatible with the synthesis of subgenomic RNA 4 by internal initiation of transcription on the RNA 3 minus strands.

Limited sequence variation in the leader sequence of RNA 4 from several strains of alfalfa mosaic virus.

The sequences of the 5'-noncoding regions of RNA 4 of seven strains of alfalfa mosaic virus were compared. In each case, the coat protein cistron was preceded by a leader sequence of 39 nucleotides (including the initiator codon). At position 26, an A-, G-, or U-residue was found.

Nucleotide sequence of the putative recognition site for coat protein in the RNAs of alfalfa mosaic virus and tobacco streak virus.

The sequence of the 3'-terminal 180 and 140 nucleotides of RNAs 2 and 3, respectively, of tobacco streak virus (TSV) was deduced by reverse transcription in the presence of a specific primer and chain terminators. Homology between the two RNAs was found to be restricted to a 3-terminal region of about 45 nucleotides. The data were compared with the sequence of the homologous region of 145 nucleotides occurring at the 3'-termini of the alfalfa mosaic virus (A1MV) RNAs, which contains the specific binding site for coat protein (Koper-Zwarthoff et al.

Complete nucleotide sequence of alfalfa mosaic virus RNA 4.

Alfalfa mosaic virus RNA 4, the subgenomic messenger for viral coat protein, was partially digested with RNase T1 or RNase A and the sequence of a number of fragments was deduced by in vitro labeling with polynucleotide kinase and application of RNA sequencing techniques. From overlapping fragments, the complete primary sequence of the 881 nucleotides of RNA 4 was constructed: the coding region of 660 nucleotides (not including the initiation and termination codon) is flanked by a 5' noncoding region of 39 nucleotides and a 3' noncoding region of 182 nucleotides. The RNA sequencing data completely confirm the amino acid sequence of the coat protein as deduced by Van Beynum et al.

Isolation and characterization of the immunoglobin of pike (Esox lucius L.).

The purification of the immunoglobul in from pike serum and its physicochemical characterization is presented. The immunoglobul in was prepared by means of gel filtration and ion exchange chromatography. Measurements in the analytical ultracentrifuge showed a sedimentation constant of 15.

Nucleotide sequence of the 3'-noncoding region of alfalfa mosaic virus RNA 4 and its homology with the genomic RNAs.

A 226-nucleotide fragment was derived from alfalfa mosaic virus RNA 4 (ALMV RNA 4), the subgenomic messenger for viral coat protein, and its sequence was deduced by in vitro labeling with polynucleotide kinase and application of RNA sequencing techniques. The fragment contains the 3'-terminal 45 nucleotides of the coat protein cistron and the complete 3'-noncoding region of 182 nucleotides. The total length of RNA 4 was calculated to be 881 nucleotides.

3'-Terminal nucleotide sequence of alfalfa mosaic virus RNA 4.

The sequence of the 3'-terminal 91 nucleotides of alfalfa mosaic virus RNA 4, the messenger for the viral coat protein, has been elucidated. A fragment containing the 3' terminus of the RNA was obtained by mild digestion with RNase T1. The primary structure of the fragment was deduced by labeling it in vitro at its 5' terminus and application of RNA sequencing techniques.

[An unusual fracture of the elbow (author's transl)].

A case of long-standing lateral condylar fracture of an elbow in a dog is reported. The fracture resulted in peripheral neuropathy of the ulnar nerve. The previous history, the findings at operation, the stable osteosynthesis permitting weight-bearing and the post-operative course are discussed.

Enzyme linked immunosorbent assay (ELISA) for determination of Staphylococcus aureus enterotoxin type B.

Determination of Staphylococcus aureus enterotoxin type B using ELISA is described. The ELISA is more sensitive than the micro-slide technique. The specificity of the determination of enterotoxin B depends on the specificity of the antisera used.

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein.

Host and virus specific RNA polymerases in alfalfa mosaic virus infected tobacco.

The particulate fraction of a homogenate of alfalfa mosaic virus infected tobacco was found to contain the viral replicase, and one or more host-specific RNA-polymerases. Using an endogeneous template, the membrane-bound replicase incorporates 3H-CTP in virion-type RNA. The synthesized RNA is part of a replicative intermediate; after RN-ase-treatment the product comigrates with viral double-stranded RNA in polyacrylamide gels.

RNA-protein interactions in alfalfa mosaic virus.

Particles of the bottom component of alfalfa mosaic virus have a compact bacilliform structure at neutral pH. When the pH is raised to 8.3 the structure unfolds.

Sterility of three brothers in connection with a disturbed carbohydrate metabolism in semen.

Sterile semen of three brothers was investigated biochemically. Most strikingly was the strong similarity of both the amino acid and the carbohydrate composition of the semen. Inside the spermatozoa much more fructose and glucose was present than normally is found.