Therapeutic and pharmacological applications of extracellular vesicles and lipoproteins.

In recent years, various approaches have been undertaken to eliminate lipoproteins co-isolated with extracellular vesicles, as they were initially regarded as contaminating entities. However, novel discoveries are reshaping our perspective. In body fluids, these distinct particles not only co-exist, but also interactions between them are likely to occur.

Reduced circulating CD63 extracellular vesicle levels associate with atherosclerosis in hypercholesterolaemic mice and humans.

Aims: The association and co-isolation of low-density lipoproteins (LDL) and extracellular vesicles (EVs) have been shown in blood plasma. Here we explore this relationship to better understand the role of EVs in atherogenesis.

Methods And Results: Wild type (WT), PCSK9, and LDLR C57BL/6 mice were used in this study.

Development of a novel rapid response event review process for quality improvement.

Introduction: Rapid response team (RRT) and code activation events occur relatively commonly in inpatient settings. RRT systems have been the subject of a significant amount of analysis, although this has been largely focused on the impact of RRT system implementation and RRT events on patient outcomes. There is reason to believe that the structured assessment of RRT and code events may be an effective way to identify opportunities for system improvement, although no standardised approach to event analysis is widely accepted.

S309-CAR-NK cells bind the Omicron variants and reduce SARS-CoV-2 viral loads in humanized ACE2-NSG mice.

Unlabelled: Recent progress on chimeric antigen receptor (CAR)-NK cells has shown promising results in treating CD19-positive lymphoid tumors with minimal toxicities [including graft versus host disease (GvHD) and cytokine release syndrome (CRS) in clinical trials. Nevertheless, the use of CAR-NK cells in combating viral infections has not yet been fully explored. Previous studies have shown that CAR-NK cells expressing S309 single-chain fragment variable (scFv), hereinafter S309-CAR-NK cells, can bind to SARS-CoV-2 wildtype pseudotyped virus (PV) and effectively kill cells expressing wild-type spike protein .

Robotic stereotactic radiosurgery for intracranial meningiomas in elderly patients: assessment of treatment efficacy and safety.

Purpose: Stereotactic radiosurgery (SRS) has been increasingly used to treat intracranial pathologies in elderly patients. The treatment efficiency of SRS has been demonstrated in meningiomas, with excellent local control. We aimed to analyze the safety of robotic SRS in elderly patients with meningiomas.

ProkBERT family: genomic language models for microbiome applications.

Background: In the evolving landscape of microbiology and microbiome analysis, the integration of machine learning is crucial for understanding complex microbial interactions, and predicting and recognizing novel functionalities within extensive datasets. However, the effectiveness of these methods in microbiology faces challenges due to the complex and heterogeneous nature of microbial data, further complicated by low signal-to-noise ratios, context-dependency, and a significant shortage of appropriately labeled datasets. This study introduces the ProkBERT model family, a collection of large language models, designed for genomic tasks.

Reproductive Profile of Neuronal Androgen Receptor Knockout Female Mice With a Low Dose of DHT.

Hyperandrogenism and polycystic ovarian syndrome result from the imbalance or increase of androgen levels in females. Androgen receptor (AR) mediates the effects of androgens, and this study examines whether neuronal AR plays a role in reproduction under normal and increased androgen conditions in female mice. The neuron-specific AR knockout (KO) mouse (SynARKO) was generated from a female mouse (synapsin promoter driven Cre) and a male mouse (Ar fl/y).

Challenges to Implementation of Community Health Worker-Led Chronic Obstructive Pulmonary Disease (COPD) Screening and Referral in Rural Uganda: A Qualitative Study using the Implementation Outcomes Framework.

Background: Chronic obstructive pulmonary disease (COPD) is the third leading cause of death globally. The burden of COPD is expected to increase in low- and middle-income countries (LMICs). COPD screening and diagnostics tools are often inaccessible in rural settings of LMICs.

Neuronal AR Regulates Glucose Homeostasis and Energy Expenditure in Lean Female Mice With Androgen Excess.

Hyperandrogenemia and polycystic ovary syndrome are a result of the imbalance of androgen levels in females. Androgen receptor (Ar) mediates the effect of androgen, and this study examines how neuronal Ar in the central nervous system mediates metabolism under normal and increased androgen conditions in female mice. The neuron-specific ARKO mouse (SynARKO) was created from female (Ar fl/wt; synapsin promoter driven Cre) and male (Ar fl/y) mice.

Corrigendum: What if: a retrospective reconstruction of resection cavity stereotactic radiosurgery to mimic neoadjuvant stereotactic radiosurgery.

[This corrects the article DOI: 10.3389/fonc.2023.

Defective neurite elongation and branching in Nibp/Trappc9 deficient zebrafish and mice.

Loss of function in transport protein particles (TRAPP) links a new set of emerging genetic disorders called "TRAPPopathies". One such disorder is NIBP syndrome, characterized by microcephaly and intellectual disability, and caused by mutations of , a crucial and unique member of TRAPPII. To investigate the neural cellular/molecular mechanisms underlying microcephaly, we developed Nibp/Trappc9-deficient animal models using different techniques, including morpholino knockdown and CRISPR/Cas mutation in zebrafish and Cre/LoxP-mediated gene targeting in mice.

Principles for task shifting hypertension and diabetes screening and referral: a qualitative study exploring patient, community health worker and healthcare professional perceptions in rural Uganda.

Background: A shortage of healthcare workers in low- and middle-income countries (LMICs) combined with a rising burden of non-communicable diseases (NCDs) like hypertension and diabetes mellitus has resulted in increasing gaps in care delivery for NCDs. As community health workers (CHWs) often play an established role in LMIC healthcare systems, these programs could be leveraged to strengthen healthcare access. The objective of this study was to explore perceptions of task shifting screening and referral for hypertension and diabetes to CHWs in rural Uganda.

Structural Adaptation of the Single-Stranded DNA-Binding Protein C-Terminal to DNA Metabolizing Partners Guides Inhibitor Design.

Single-stranded DNA-binding protein (SSB) is a bacterial interaction hub and an appealing target for antimicrobial therapy. Understanding the structural adaptation of the disordered SSB C-terminus (SSB-Ct) to DNA metabolizing enzymes (e.g.

What if: A retrospective reconstruction of resection cavity stereotactic radiosurgery to mimic neoadjuvant stereotactic radiosurgery.

Introduction: Neoadjuvant stereotactic radiosurgery (NaSRS) of brain metastases has gained importance, but it is not routinely performed. While awaiting the results of prospective studies, we aimed to analyze the changes in the volume of brain metastases irradiated pre- and postoperatively and the resulting dosimetric effects on normal brain tissue (NBT).

Methods: We identified patients treated with SRS at our institution to compare hypothetical preoperative gross tumor and planning target volumes (pre-GTV and pre-PTV) with original postoperative resection cavity volumes (post-GTV and post-PTV) as well as with a standardized-hypothetical PTV with 2.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production.

Decoding molecular programs in melanoma brain metastases.

Melanoma brain metastases (MBM) variably respond to therapeutic interventions; thus determining patient's prognosis. However, the mechanisms that govern therapy response are poorly understood. Here, we use a multi-OMICS approach and targeted sequencing (TargetSeq) to unravel the programs that potentially control the development of progressive intracranial disease.

Quality Improvement Targeting Non-pharmacologic Care and As-needed Morphine Improves Outcomes in Neonatal Abstinence Syndrome.

Unlabelled: Despite the rising incidence of neonatal abstinence syndrome (NAS), there remains wide practice variation in its management. Many recent studies have focused on implementing new symptom scoring systems, typically as part of larger improvement interventions. Despite the continued use of the Finnegan Scoring System, we performed a quality improvement project to reduce the day of life at discharge and cumulative opioid exposure for newborns with NAS.

Comparison of BNT162b2-, mRNA-1273- and Ad26.COV2.S-Elicited IgG and Neutralizing Titers against SARS-CoV-2 and Its Variants.

Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.

Effectiveness of a community health worker-delivered care intervention for hypertension control in Uganda: study protocol for a stepped wedge, cluster randomized control trial.

Background: Over 80% of the morbidity and mortality related to non-communicable diseases (NCDs) occurs in low-income and middle-income countries (LMICs). Community health workers (CHWs) may improve disease control and medication adherence among patients with NCDs in LMICs, particularly in sub-Saharan African settings. In Uganda, and the majority of LMICs, management of uncontrolled hypertension remains limited in constrained health systems.

Microglia-Specific Promoter Activities of Gene.

Adeno-associated virus (AAV)-mediated genetic targeting of microglia remains a challenge. Overcoming this hurdle is essential for gene editing in the central nervous system (CNS). Here, we characterized the minimal/native promoter of the gene, which is known to be specifically and stably expressed in the microglia during homeostatic and pathological conditions.

Epigallocatechin gallate from green tea effectively blocks infection of SARS-CoV-2 and new variants by inhibiting spike binding to ACE2 receptor.

Background: As the COVID-19 pandemic rages on, the new SARS-CoV-2 variants have emerged in the different regions of the world. These newly emerged variants have mutations in their spike (S) protein that may confer resistance to vaccine-elicited immunity and existing neutralizing antibody therapeutics. Therefore, there is still an urgent need of safe, effective, and affordable agents for prevention/treatment of SARS-CoV-2 and its variant infection.

Novel Scalable and Simplified System to Generate Microglia-Containing Cerebral Organoids From Human Induced Pluripotent Stem Cells.

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues.