Engineering an oncolytic adenoviral platform for precise delivery of antisense peptide nucleic acid to modulate PD-L1 overexpression in cancer cells.

Cancer immunotherapy is focused on stimulating the immune system against cancer cells by exploiting immune checkpoint mechanisms. PD-1/PD-L1 is one of the most known immune checkpoints due to the widespread upregulation of the Programmed Death Ligand 1 (PD-L1) transmembrane protein in cancer tissues. Accordingly, taking advantage of the ability of oncolytic adenoviruses (OAd) to specifically infect and kill tumor cells over healthy ones, here, we developed a targeted delivery platform based on OAd to selectively deliver in cancer cells an antisense peptide nucleic acid (PNA) targeting the PD-L1 mRNA.

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin HTCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT) (Q), the 5'-5' stacked G4-dimer [d(CGGAGGT)] (Q), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')] (Q).

Carrier capability of halloysite nanotubes for the intracellular delivery of antisense PNA targeting mRNA of neuroglobin gene.

Peptide nucleic acid (PNA) is a DNA mimic that shows good stability against nucleases and proteases, forming strongly recognized complementary strands of DNA and RNA. However, due to its feeble ability to cross the cellular membrane, PNA activity and its targeting gene action is limited. Halloysite nanotubes (HNTs) are a natural and low-cost aluminosilicate clay.

Exploring the DNA-PNA heterotriplex formation in targeting the Bcl-2 gene promoter: A structural insight by physico-chemical and microsecond-scale MD investigation.

Peptide Nucleic Acids (PNAs) represent a promising tool for gene modulation in anticancer treatment. The uncharged peptidyl backbone and the resistance to chemical and enzymatic degradation make PNAs highly advantageous to form stable hybrid complexes with complementary DNA and RNA strands, providing higher stability than the corresponding natural analogues. Our and other groups' research has successfully shown that tailored PNA sequences can effectively downregulate the expression of human oncogenes using antigene, antisense, or anti-miRNA approaches.

Polymorphism of G-quadruplexes formed by short oligonucleotides containing a 3'-3' inversion of polarity: From G:C:G:C tetrads to π-π stacked G-wires.

G-wires are supramolecular DNA structures based on the G-quadruplex (G4) structural motif obtained by the self-assembly of interlocked slipped G-rich oligonucleotide (ON) strands, or by end-to-end stacking of G4 units. Despite the increasing interest towards G-wires due to their potential applications in DNA nanotechnologies, the self-assembly process to obtain G-wires having a predefined length and stability is still neither completely understood nor controlled. In our previous studies, we demonstrated that the d(5'CG-3'-3'-GC5') ON, characterized by the presence of a 3'-3'-inversion of polarity site self-assembles into a G-wire structure when annealed in the presence of K ions.

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry.

State of art in the chemistry of nucleoside-based Pt(II) complexes.

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.

Exploring the Relationship between G-Quadruplex Nucleic Acids and Plants: From Plant G-Quadruplex Function to Phytochemical G4 Ligands with Pharmaceutic Potential.

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies.

Development of Surface Chemical Strategies for Synthesizing Redox-Responsive Diatomite Nanoparticles as a Green Platform for On-Demand Intracellular Release of an Antisense Peptide Nucleic Acid Anticancer Agent.

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies.

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1'-uracilyl)-2-propanone on Serum Albumin Structure.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein.

Cytosine-rich oligonucleotides incorporating a non-nucleotide loop: A further step towards the obtainment of physiologically stable i-motif DNA.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(ACA) and d(C) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation.

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively.

Exploring a peptide nucleic acid-based antisense approach for CD5 targeting in chronic lymphocytic leukemia.

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies.

Assisting PNA transport through cystic fibrosis human airway epithelia with biodegradable hybrid lipid-polymer nanoparticles.

Cystic fibrosis (CF) is characterized by an airway obstruction caused by a thick mucus due to a malfunctioning Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein. The sticky mucus restricts drugs in reaching target cells limiting the efficiency of treatments. The development of new approaches to enhance drug delivery to the lungs represents CF treatment's main challenge.

Bioconjugation of a PNA Probe to Zinc Oxide Nanowires for Label-Free Sensing.

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis.

PNA-Based Graphene Oxide/Porous Silicon Hybrid Biosensor: Towards a Label-Free Optical Assay for Brugada Syndrome.

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS).

Probing the DNA Reactivity and the Anticancer Properties of a Novel Tubercidin-Pt(II) Complex.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium . In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin.

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets.

New Linear Precursors of cIDPR Derivatives as Stable Analogs of cADPR: A Potent Second Messenger with Ca-Modulating Activity Isolated from Sea Urchin Eggs.

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the "northern" ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5'-sugar positions. Preliminary Ca mobilization assays, performed on differentiated C2C12 cells, are reported as well.

New G-Quadruplex-Forming Oligodeoxynucleotides Incorporating a Bifunctional Double-Ended Linker (DEL): Effects of DEL Size and ODNs Orientation on the Topology, Stability, and Molecularity of DEL-G-Quadruplexes.

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG₄T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG₄T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC⁻size-exclusion chromatography (HPLC⁻SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG₄T)₄.

Peptide Nucleic Acid-Functionalized Adenoviral Vectors Targeting G-Quadruplexes in the P1 Promoter of Bcl-2 Proto-Oncogene: A New Tool for Gene Modulation in Anticancer Therapy.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs).

Design, Synthesis and Characterization of Novel Co-Polymers Decorated with Peptides for the Selective Nanoparticle Transport across the Cerebral Endothelium.

The development of new strategies for enhancing drug delivery to the brain represents a major challenge in treating cerebral diseases. In this paper, we report on the synthesis and structural characterization of a biocompatible nanoparticle (NP) made up of poly(lactic-co-glycolic acid) (PLGA)-polyethylene glycol (PEG) co-polymer (namely PELGA) functionalized with the membranotropic peptide gH625 (gH) and the iron-mimicking peptide CRTIGPSVC (CRT) for transport across the blood-brain barrier (BBB). gH possesses a high translocation potency of the cell membrane.

Shuttle-mediated nanoparticle transport across an in vitro brain endothelium under flow conditions.

The blood brain barrier (BBB) represents a challenge in the development of new nano-delivery systems able to reach the central nervous system (CNS). In order to test the efficacy of these nanocarriers, it is fundamental to use in vitro models that resemble the in vivo cell culture conditions. Here, we demonstrate for the first time the ability of a membranotropic peptide, namely gH625, to transport a cargo-acting as a shuttle-across the BBB layer under flow conditions that mimic the blood flow rate.

From square to circular polymeric microchannels by spin coating technology: a low cost platform for endothelial cell culture.

Square microchannels are easy to fabricate by means of micromachining or lithographic techniques. However, in vitro vascular microcapillaries--as well as plug production and microparticle alignment--require mainly circular microchannels that can be used also in applications based on open microchannels. Nowadays, a simple, low cost, and versatile method to fabricate circular microchannels is still missing.