Self-Assembled Chiral Film Based on Melanin Polymers.

Chirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA.

Synthesis of obovatol and related neolignan analogues as α-glucosidase and α-amylase inhibitors.

Diabetes mellitus is a metabolic disease characterized by hyperglycemia, which can be counteracted by the inhibition of α-glucosidase (α-Glu) and α-amylase (α-Amy), enzymes responsible for the hydrolysis of carbohydrates. In recent decades, many natural compounds and their bioinspired analogues have been studied as α-Glu and α-Amy inhibitors. However, no studies have been devoted to the evaluation of α-Glu and α-Amy inhibition by the neolignan obovatol (1).

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin HTCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT) (Q), the 5'-5' stacked G4-dimer [d(CGGAGGT)] (Q), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')] (Q).

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions.

Electronic Circular Dichroism Detects Conformational Changes Associated with Proteasome Gating Confirmed Using AFM Imaging.

Many chronic diseases, including cancer and neurodegeneration, are linked to proteasome dysregulation. Proteasome activity, essential for maintaining proteostasis in a cell, is controlled by the gating mechanism and its underlying conformational transitions. Thus, developing effective methods to detect gate-related specific proteasome conformations could be a significant contribution to rational drug design.

Chiroptical Properties of Z-DNA Using Ionic Porphyrins and Metalloporphyrins.

The non-covalent interaction of achiral porphyrins with nucleic acids has been extensively studied, and various macrocycles have been indeed utilized as reporters of different sequences of DNA bases. Nevertheless, few studies have been published on the capability of these macrocycles to discriminate among the various nucleic acid conformations. Circular dichroism spectroscopy allowed to characterize the binding of several cationic and anionic mesoporphyrins and metallo derivatives with Z-DNA, in order to exploit the functionality of these systems as probes, storing system, and logic gate.

Carbon dots as a versatile tool to monitor insulin aggregation.

The possibility to monitor peptide and protein aggregation is of paramount importance in the so-called conformational diseases, as the understanding of many physiological pathways, as well as pathological processes involved in the development of such diseases, depends very much on the actual possibility to monitor biomolecule oligomeric distribution and aggregation. In this work, we report a novel experimental method to monitor protein aggregation, based on the change of the fluorescent properties of carbon dots upon protein binding. The results obtained in the case of insulin with this newly proposed experimental approach are compared with those obtained with other common experimental techniques normally used for the same purpose (circular dichroism, DLS, PICUP and ThT fluorescence).

Enantiomeric Resolution and Enantiomer Isolation of H TPPS4 J-Aggregate from Aqueous Solution Is Enabled by Vortexes.

Protonated achiral H TPPS4 spontaneously self-arranges at acids pH and high ionic strength to build mesoscopic J-aggregates that are intrinsically chiral. According to the symmetry rule aggregation leads to a racemate that, however, can be unbalanced by chemical (chiral pollutants) or physical stimuli (as vortexing the solution). Vortexing the title racemate, in principle, might either induce chiral separation or chiral enrichment.

Modulation of the 20S Proteasome Activity by Porphyrin Derivatives Is Steered through Their Charge Distribution.

Cationic porphyrins exhibit an amazing variety of binding modes and inhibition mechanisms of 20S proteasome. Depending on the spatial distribution of their electrostatic charges, they can occupy different sites on α rings of 20S proteasome by exploiting the structural code responsible for the interaction with regulatory proteins. Indeed, they can act as competitive or allosteric inhibitors by binding at the substrate gate or at the grooves between the α subunits, respectively.

Carbon dots surface chemistry drives fluorescent properties: New tools to distinguish isobaric peptides.

The possibility to design rational carbon dots surface functionalization for specific analytical and bioanalytical applications is hindered by the lack of a full knowledge of the surface chemical features driving fluorescent properties. In this model study, we have synthesized four different peptides, three of which are isobaric and not distinguishable by common MSMS experiments. After having characterized the peptides conformations by CD analyses, we have covalently bonded all four peptides to carbon dots by using different experimental procedures, which produce different functional groups on the carbon dots surface.

Self-Assembly of Discrete Porphyrin/Calix[4]tube Complexes Promoted by Potassium Ion Encapsulation.

The pivotal role played by potassium ions in the noncovalent synthesis of discrete porphyrin-calixarene nanostructures has been examined. The conformation adopted by the two cavities of octa-cationic calix[4]tube was found to prevent the formation of complexes with well-defined stoichiometry between this novel water-soluble calixarene and the tetra-anionic phenylsulfonate porphyrin . Conversely, preorganization of into a -symmetrical scaffold, triggered by potassium ion encapsulation (@K), allowed us to carry out an efficient hierarchical self-assembly process leading to 2D and 3D nanostructures.

En Route to a Chiral Melanin: The Dynamic "From-Imprinted-to-Template" Supramolecular Role of Porphyrin Hetero-Aggregates During the Oxidative Polymerization of L-DOPA.

Chiral porphyrin hetero-aggregates, produced from meso-tetrakis(4-N-methylpyridyl) porphyrin HT4 and copper(II) meso-tetrakis(4-sulfonatophenyl)porphyrin CuTPPS by an imprinting effect in the presence of L-3,4-dihydroxyphenylalanine (L-DOPA), are shown herein to serve as templates for the generation of chiral structures during the oxidative conversion of the amino acid to melanin. This remarkable phenomenon is suggested to involve the initial role of L-DOPA and related chiral intermediates like dopachrome as templates for the production of chiral porphyrin aggregates. When the entire chiral pool from DOPA is lost, chiral porphyrin hetero-aggregate would elicit axially chiral oligomer formation from 5,6-dihydroxyindole intermediates in the later stages of melanin synthesis.

Cooperative Binding of the Cationic Porphyrin Tris-T4 Enhances Catalytic Activity of 20S Proteasome Unveiling a Complex Distribution of Functional States.

The present study provides new evidence that cationic porphyrins may be considered as tunable platforms to interfere with the structural "key code" present on the 20S proteasome α-rings and, by consequence, with its catalytic activity. Here, we describe the functional and conformational effects on the 20S proteasome induced by the cooperative binding of the tri-cationic 5-(phenyl)-10,15,20-(tri -methyl-4-pyridyl) porphyrin (Tris-T4). Our integrated kinetic, NMR, and in silico analysis allowed us to disclose a complex effect on the 20S catalytic activity depending on substrate/porphyrin concentration.

Interactions of mono spermine porphyrin derivative with DNAs.

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC) in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC) .

Photodegradation of Antibiotics by Noncovalent Porphyrin-Functionalized TiO in Water for the Bacterial Antibiotic Resistance Risk Management.

Antibiotics represent essential drugs to contrast the insurgence of bacterial infections in humans and animals. Their extensive use in livestock farming, including aquaculture, has improved production performances and food safety. However, their overuse can implicate a risk of water pollution and related antimicrobial resistance.

Optimization of ZnO Nanorods Growth on Polyetheresulfone Electrospun Mats to Promote Antibacterial Properties.

Zinc oxide (ZnO) nanorods grown by chemical bath deposition (CBD) on the surface of polyetheresulfone (PES) electrospun fibers confer antimicrobial properties to the obtained hybrid inorganic-polymeric PES/ZnO mats. In particular, a decrement of bacteria colony forming units (CFU) is observed for both negative () and positive ( and ) Grams. Since antimicrobial action is strictly related to the quantity of ZnO present on surface, a CBD process optimization is performed to achieve the best results in terms of coverage uniformity and reproducibility.

Long-Range Chiral Induction by a Fully Noncovalent Approach in Supramolecular Porphyrin-Calixarene Assemblies.

The hierarchical assembly, in aqueous solution, of a new multi-metalloporphyrin/calixarene aggregate has been accomplished. In this supramolecular system transfer of chirality, from the outermost components to the central porphyrin reporter, takes place as a result of favorable and fully noncovalent long-range electronic communication.

Polyethersulfone Mats Functionalized with Porphyrin for Removal of Para-nitroaniline from Aqueous Solution.

The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water.

Combined Approach To Remove and Fast Detect Heavy Metals in Water Based on PES-TiO Electrospun Mats and Porphyrin Chemosensors.

Hybrid poly(ether sulfones) (PES)-TiO electrospun mats are used as selective filters to remove lead and zinc ions from water. Presence of TiO is functional to trigger fiber's surface charge that allows for better performances in terms of ionic adsorption with respect to bare PES mats. Temperature increase promotes a speed up of ion removal.

An Ultra High-Frequency 8-Channel Neurostimulator Circuit With [Formula: see text] Peak Power Efficiency.

In order to recruit neurons in excitable tissue, constant current neural stimulators are commonly used. Recently, ultra high-frequency (UHF) stimulation has been proposed and proven to have the same efficacy as constant-current stimulation. UHF stimulation uses a fundamentally different way of activating the tissue: each stimulation phase is made of a burst of current pulses with adjustable amplitude injected into the tissue at a high (e.

Comments on "Compact, Energy-Efficient High-Frequency Switched Capacitor Neural Stimulator With Active Charge Balancing".

This manuscript points out some mistakes in the Introduction and in the table of comparison of a paper already published in this journal by Hsu and Schmid [1]. Although the main claim of [1] is still preserved, we believe the paper needs to be rectified for scientific correctness of the work.

Chiral Recognition of L- and D- Amino Acid by Porphyrin Supramolecular Aggregates.

We report of the interactions between four amino acids lysine (Lys), arginine (Arg), histidine (His), and phenylalanine (Phe) with the J-aggregates of the protonated 5,10,15,20-tetrakis(4-sulfonatophenyl)-porphyrin H₄TPPS. Several aspects of these self-assembled systems have been analyzed: (i) the chiral transfer process; (ii) the hierarchical effects leading to the aggregates formation; and, (iii) the influence of the amino acid concentrations on both transferring and storing chiral information. We have demonstrated that the efficient control on the J-aggregates chirality is obtained when all amino acids are tested and that the chirality transfer process is under hierarchical control.

Interactions Between Spermine-Derivatized Tentacle Porphyrins and The Human Telomeric DNA G-Quadruplex.

G-rich DNA sequences have the potential to fold into non-canonical G-Quadruplex (GQ) structures implicated in aging and human diseases, notably cancers. Because stabilization of GQs at telomeres and oncogene promoters may prevent cancer, there is an interest in developing small molecules that selectively target GQs. Herein, we investigate the interactions of -tetrakis-(4-carboxysperminephenyl)porphyrin (TCPPSpm4) and its Zn(II) derivative (ZnTCPPSpm4) with human telomeric DNA (Tel22) via UV-Vis, circular dichroism (CD), and fluorescence spectroscopies, resonance light scattering (RLS), and fluorescence resonance energy transfer (FRET) assays.

Design principles of chiral carbon nanodots help convey chirality from molecular to nanoscale level.

The chirality of (nano)structures is paramount in many phenomena, including biological processes, self-assembly, enantioselective reactions, and light or electron spin polarization. In the quest for new chiral materials, metallo-organic hybrids have been attractive candidates for exploiting the aforementioned scientific fields. Here, we show that chiral carbon nanoparticles, called carbon nanodots, can be readily prepared using hydrothermal microwave-assisted synthesis and easily purified.

Chirality Enhancement of Porphyrin Supramolecular Assembly Driven by a Template Preorganization Effect.

Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.