Publications by authors named "A S Saribas"
Article Synopsis
- * Some polyomaviruses can cause serious diseases such as polyomavirus-associated nephropathy, progressive multifocal leukoencephalopathy, trichodysplasia spinulosa, and Merkel cell carcinoma.
- * Recent research focuses on the functions of viral proteins and microRNA that these viruses express, shedding light on their role in viral biology, how they transform cells, and their potential impact on disease progression.
Article Synopsis
- - The study evaluated the participation of public health laboratories (PHLs) in a tuberculosis external quality assessment (EQA) program over three years (2018-2020), managed by the National Tuberculosis Reference Laboratory (NTRL).
- - Each year, PHLs performed tests on various EQA samples across microscopy, culture, and drug susceptibility testing, with results recorded and analyzed through the Tuberculosis Laboratories Surveillance Network (TULSA).
- - Results showed fluctuating participation numbers and noteworthy performance statistics, indicating that engaging in EQA positively impacts the accuracy and reliability of tuberculosis testing methods in laboratories.
We previously reported the discovery and characterization of two novel proteins (ORF1 and ORF2) generated by the alternative splicing of the JC virus (JCV) late coding region. Here, we report the discovery and partial characterization of three additional novel ORFs from the same coding region, ORF3, ORF4 and ORF5, which potentially encode 70, 173 and 265 amino acid long proteins respectively. While ORF3 protein exhibits a uniform distribution pattern throughout the cells, we were unable to detect ORF5 expression.
View Article and Find Full Text PDFBoosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production.
View Article and Find Full Text PDF